Southeastern Naturalist 451 A.M. Redmond, E.K. Hollingsworth, and M.L. Vis 22001199 SOUTHEASTERN NATURALIST 1V8o(3l.) :1485,1 N–4o6. 83 Survey of Freshwater Red Algae from the Batrachospermales (Rhodophyta) in South Carolina Alexis M. Redmond1, Emily K. Hollingsworth2, and Morgan L. Vis1,* Abstract - Freshwater red algae are important components of the algal flora in streams and rivers with high water quality. The order Batrachospermales is the most speciesrich portion of the red algal taxa reported throughout North America. We investigated 30 stream segments in South Carolina for the presence of freshwater red algae classified within the Batrachospermales. We collected a total of 50 specimens representing 7 genera and 9 species. We documented Batrachospermum gelatinosum, B. turfosum, Kumanoa skujana, Montagnia australis, Sheathia americana, S. heterocortica, Sirodotia suecica, Tuomeya americana, and Virescentia viride-americana. We observed M. australis and T. americana from the greatest number of streams and in multiple years from the same site. We observed V. viride-americana in 3 streams; our specimens represent the only new record for the state. We generated DNA sequence data of the rbcL gene or gleaned it from the literature for 8 of the 9 taxa identified in the study and confirmed their morphological identification. We collected stream temperature, pH, and conductivity data from sites where we collected 6 of the taxa (Batrachospermum gelatinosum, B. turfosum, M. australis, Sheathia americana, T. americana, and V. viride-americana). Our records were within previously reported ranges for these taxa, although water temperatures tended to be higher than those in previous reports. Present data for the diversity of Batrachospermales in South Carolina represent 64% of the generic/infrageneric and 20% of the species diversity known for North America. This diversity may still be an underestimation of what might be detected by future studies that target more specialized habitats; taxa that are known from neighboring states but not yet reported from South Carolina might be discovered. Introduction Freshwater red algae occur most often in shallow streams with moderate water flow but are found in a variety of habitats (Sheath and Vis 2015). Although various species have been collected from streams with diverse environmental characteristics, they are most common in streams with pH 6–7, low to moderate nutrient concentrations, and low illumination (Eloranta and Kwandrans 2007, Sheath and Hambrook 1990, Sheath and Vis 2015). As a result, several red algal species have been used as bioindicators of higher water quality in North America and Europe (Stancheva and Sheath 2016). These red algae are also important components of aquatic ecosystems, serving as both food and shelter for macroinvertebrates (Sheath et al. 1995, 1996). Freshwater taxa are distributed throughout most of the rhodophyte lineage (Kumano 2002, Yoon et al. 2006). However, the order Batrachospermales is the 1Department of Environmental and Plant Biology, Ohio University, Athens, OH 45701. 28420 Williams Road, Montague, MI 49437. *Corresponding author - vis-chia@ohio.edu. Manuscript Editor: Robert Krentz Southeastern Naturalist A.M. Redmond, E.K.. Hollingsworth, and M.L. Vis 2019 Vol. 18, No. 3 452 most taxon-rich, comprising ~150 species (Sheath 1984). Since the first molecular systematics study of members of this order, the species originally assigned to the genus Batrachospermum have been shown to be paraphyletic, with the result that several new genera have been recently described (Chapuis et al. 2017; Entwisle et al. 2009; Necchi et al. 2018, 2019; Salomaki et al. 2014). These latest studies have shown some taxa to be morphologically cryptic, and can be positively identified only by using DNA sequence data. For example, there are multiple species within the genus Sheathia that are so similar in appearance that genetic data are needed to distinguish Sheathia americana from S. heterocortica (Salomaki et al. 2014). This requirement can be problematic in evaluating historic records (based solely on morphology), and some identifications remain ambiguous (Table 1). The state of South Carolina has 5 distinct ecoregions. In this study, we sampled the 3 largest ecoregions (Piedmont, Southeastern Plains, and the Middle Atlantic Coastal Plain), as prior studies suggested that rhodophytes have been identified only in these ecoregions (Griffith et al. 2002). The Piedmont ecoregion is in the central area of the state and serves as a transition between the mountains and the flat coastal plains. The Southeastern Plains region is primarily an agricultural landscape with crops, farmland, forests, and woodlands. The streams in the Middle Atlantic Coastal Plain tend to be humic and stained due to tannins from the dominant Pinus (pine) vegetation and have a primarily sandy substrate (Carey et al. 2007). In South Carolina, freshwater red algae from the Compsopogonales, Acrochaetiales, and Batrachospermales have been previously reported (Table 1 and the references therein). Similar to the general trend in taxonomic distribution in North America, the majority of taxa identified were from the Batrachospermales, with 11 species representing 7 genera. Many of these collections were recorded prior to the first molecular systematics publications on freshwater red algae (Vis et al. 1998). Therefore, we undertook the present study to re-survey freshwater red algae of the Batrachospermales in the state, with a focus on comparing previous records of Batrachospermales in conjunction with DNA sequence data for identification, and broadening the knowledge base of stream environmental data for these taxa. Methods We sampled freshwater red algal specimens from 30 locations in South Carolina primarily during the period May–September from 2008, 2009, 2010, and 2012 (Fig. 1, Appendix 1). Of these, we visited 18 sites once, while we made collections from 12 of them in multiple years (Appendix 1). We categorized each site based on ecoregion: Southeastern Plains (17), Piedmont (12), or Middle Atlantic Coastal Plain (1) (Griffith et al. 2002). Stream habitats varied from open to closed canopy and from slow-moving waters to sites with higher current velocity (Fig. 2). At each location, we measured water temperature, pH, and conductivity in situ using a YSI Professional Plus multiparameter instrument (YSI, Yellow Springs, OH). Due to equipment failure, we did not obtain stream measurements at some sites and on some dates. Southeastern Naturalist 453 A.M. Redmond, E.K. Hollingsworth, and M.L. Vis 2019 Vol. 18, No. 3 We deposited a pressed herbarium voucher for each specimen in the Bartley Herbarium Ohio University (BHO). We dried some samples in silica desiccant for use in DNA extraction. We identified all specimens using morphological characteristics and standard taxonomic literature (Kumano 2002, Necchi and Vis 2012, Salomaki et al. 2014) with taxonomy updated using AlgaeBase (Guiry and Guiry 2018). We ground samples for DNA sequencing in liquid nitrogen with a mortar and pestle. We extracted DNA using the NucleoSpin Plant II DNA kit (Macherey- Table 1. Freshwater red algae previously reported from South Carolina. Nomenclature updated using Algaebase (Guiry and Guiry 2018). Taxon Reference Compsopogonales Boldia erythrosiphon Herndon Dillard (1967), Howard and Parker (1980), Jacobs (1968) Compsopogon caeruleus (Balbis ex C.Agardh) Jacobs (1968) Montagne Acrochaetiales Audouinella hermannii (Roth) Duby (as A. Dillard (1967), Necchi et al. (1993a) violacea) Batrachospermales Batrachospermum section Batrachospermum B. gelatinosum (L.) De Candolle (as B. House et al. (2010), Sheath and Cole (1993), moniliforme) Vis et al. (1996) B. trichocontortum Sheath & M.L.Vis Vis and Sheath (1996) Batrachospermum section Turfosa B. turfosum Bory (as B. vagum) Jacobs (1968), Wolle (1882) K. skujana (Necchi) Necchi & M.L.Vis Vis et al. (2012) Lemanea L. fucina Bory Dillard (1967) Montagnia M. australis Montagne (as Audouinella Necchi et al. (1993b), Sheath et al. (1994) macrospora) Kumanoa Paralemanea Paralemanea grandis (Wolle) S. Kumano (as L. Atkinson (1931) emanea australis) Sheathia S. americana Salomaki & M.L.Vis Salomaki et al. (2014) S. heterocortica (Sheath & K.M.Cole) Salomaki Salomaki et al. (2014), Vis et al. (1996) & M.L.Vis AS. americana or S. heterocortica Sirodotia S. suecica Kylin Lam et al. (2012), Necchi et al. (1993c) Tuomeya T. americana (Kützing) Papenfuss (as T. Dillard (1967), Goldstein and Manzi (1976), fluviatilis) Jacobs (1968) AVis et al. (1996) reported Batrachospermum boryanum. However, S. boryana only occurs in Europe and it is unclear whether the current name would be S. americana or S. heterocortica because these species can only be distinguished with sequence data (see Salomaki et al. 2014). Southeastern Naturalist A.M. Redmond, E.K.. Hollingsworth, and M.L. Vis 2019 Vol. 18, No. 3 454 Nagel, Düren, DE) according to the manufacturer’s protocol. We conducted a polymerase chain reaction (PCR) using an Applied Biosystems 2720 Thermocycler (Applied Biosystems, Foster City, CA) to amplify a 1282-bp fragment of the chloroplast rubisco large subunit gene (rbcL). The primers we used to amplify this region were F160 and rbcLR (Vis et al. 1998). The PCR reaction mix consisted of 32.75 μL dH2O, 5.0 μL 10x buffer, 4.0 μL dNTP, 4.0 μL MgCl2, 0.25 μL Ex Taq (Takara Bio Inc., Mountain View, CA), 1.5 μL of each amplification primer, and 1.0 μL of extracted DNA. The PCR thermocycler conditions were as follows: an initial denaturing at 95 °C for 1 h, followed by 35 cycles of 93 °C for 30 min, 50 °C for 30 min, and 72 °C for 1 h. We used the UltraClean® PCR Clean-up DNA purification kit (Mo Bio, Carlsbad, CA) to purify the PCR products and sequenced them at the Figure 1. Map of South Carolina showing location of collection sites. More information about ecoregions and collection sites in Appendix 1. Figure 2 (following page). Representative habitats in which freshwater red algae were collected. (A) A site in the Mid-Atlantic Coastal Plain with shallow, nearly stagnant, waters, sand and muck substrate, and Taxodium distichum (L.) Rich. (Bald Cypress) trees in the water and on the bank. (B) A site in the Southeastern Plains with sandy substrate, moderately flowing waters and shade from overhanging vegetation. (C) A site in the Piedmont with swift rapids over boulder and rock substrate and an open canopy. Southeastern Naturalist 455 A.M. Redmond, E.K. Hollingsworth, and M.L. Vis 2019 Vol. 18, No. 3 Figure 2. [Caption on preceding page.] Southeastern Naturalist A.M. Redmond, E.K.. Hollingsworth, and M.L. Vis 2019 Vol. 18, No. 3 456 Ohio University Genomics Facility. We used additional internal primers to fully sequence the 1282-bp in both sense and anti-sense directions (Table 2). We used Sequencher® version 5.2.4 (GeneCodes Corp, Ann Arbor, MI) to assemble DNA fragments and submitted final sequences to GenBank. We searched GenBank for rbcL sequences of the same species as determined from our morphological assessment. We combined the sequences from this study with sequences of the same species and a wide range of Batrachospermales taxa to build a phylogeny. If more than 1 specimen from this study had an identical sequence, we included only 1 representative sequence in subsequent phylogenetic analyses. We subjected a total of 46 sequences to maximum likelihood (ML) using RAxML (Stamatakis 2014) and Bayesian inference (BI) analysis using MrBayes v.3.2 (Ronquist et al. 2012) in Geneious plug-ins V10.2.3 (Kearse et al. 2012). We employed a GTR+G model for both the ML and BI analyses. To determine support values, we conducted 1000 ML bootstrap replicates and, for the BI posterior probabilities, 3 × 106 generations sampling every 100 generations with the first 250 generated trees removed as burn-in. Results The 30 streams from which we collected freshwater red algal taxa varied in several key environmental conditions (Appendix 1). Among the 12 Piedmont sites, min–max (and mean) values varied for water temperature from 21 °C to 30 °C (23 °C), pH from 6.2 to 7.3 (7), and specific conductance from 31 μS cm-1 to 138 μS cm-1 (65 μS cm-1). We sampled the 17 Southeastern Plains sites when the water temperature was relatively warm (19–29 °C [mean = 24 °C)]; pH was acidic to neutral (5.2–7.5)—most streams were acidic (mean pH = 5.3)—and specific conductance was low (min–max = 2–195 μS cm-1, mean = 26). We recorded no chemical stream Table 2. Internal primers used for sequencing. Herbarium numbers as in Appendix 1. Internal Primer Primer Sequence 5’-3’ BHO Number R472.4 GGAACTATTGTTGAGCGCGAAAG A-1083, A-1089, A-1094 R897 GCAGGTAACTCAACTTATTCTCG A-0118, A-0125 R897.1 GCTGGTAATTCAACATACTACG A-0024, A-0093, A-0149, A-0151, A-0153, A-0157, A-0291, A-0293, A-0295, A-0297, A-0312, A-0313, A-1085 F650 ATTAACTCTCAACCATTTATGCG A-0024, A-0093, A-0118, A-0125, A-0291, A-0293, A-0295, A-0297, A-0312, A-0313, A-1083, A-1085, A-1089, A-1094 F650.1 ATTAATTCTCAGCCTTTCATGCG A-0149, A-0151, A-0153, A-0157 F1087.1 ATCATTTAAGTGTTAATCTACCTC A-0157 F1087.71 GTCATTTAGATGTTAATTTACCTC A-1094 Southeastern Naturalist 457 A.M. Redmond, E.K. Hollingsworth, and M.L. Vis 2019 Vol. 18, No. 3 data at the 1 site in the Middle Atlantic Coastal Plain. For the most part, the streams in the Southeastern Plains had an acidic pH, whereas those in the Piedmont were more neutral (mean = 5.3 and 7.0, respectively). Although there were a few streams in the 2 regions that had specific conductance greater than 100 μS cm-1, these regions were very similar overall (mean = 65 μS cm-1 and 26 μS cm-1, respectively). The stream temperatures all reflected the season—summer—in which it was measured (mean = 23 °C and 24 °C, respectively) (Appendix 1). From the 30 sites, we collected and identified 50 specimens as members of 7 genera and 9 species within the Batrachospermales (Appendix 1). Montagnia australis was the most frequently occurring species; specimens were collected from a total of 13 streams and it was present in more than 1 year in 7 of the 8 streams sampled in multiple years (Appendix 1). We documented Tuomeya americana in 11 streams and in more than 1 year from 5 of those streams. We observed the remaining taxa in a single year: Virescentia viride-americana in 5 streams; Sheathia heterocortica in 3 streams; B. turfosum in 2 streams; and Kumanoa skujana, Sheathia americana, Sirodotia suecica, and B. gelatinosum in a single stream each. Of the 30 streams sampled, 24 streams contained a single species, 4 streams had 2 species, and there was a single stream with 3 species as well as 1 stream with 4 species (Appendix 1). We obtained associated water temperature, pH, and specific conductance for 9 of the species collected (Appendix 1). At 1 B. gelatinosum location, we collected the following data: water temperature = 22 °C, pH = 6.2, and a specific conductance of 51 μS cm-1. Stream data were available for the 3 V. viride-americana specimens, with water temperatures varying from 19 °C to 30 °C, a circumneutral pH (min–max = 6.9–7.5), and specific conductance from 45 μS cm-1 to 195 μS cm- 1. We collected 15 specimens of M. australis in waters with temperatures ranging from 20 °C to 27 °C, acidic pH (min–max = 5.2–6.3), and low specific conductance (min–max = 2–30 μS cm-1). We collected B. turfosum from 2 sites that had data water temperatures of 23 °C and 28 °C, acidic pH of 5.6 and 5.8, and low specific conductance 21 μS cm-1 and 25 μS cm-1, respectively. We obtained stream data for 3 Sheathia heterocortica specimens: water temperature = 22–23 °C, pH = 6.2–6.9, and specific conductance = 45–119 μS cm-1. We collected 10 T. americana specimens in streams with temperatures of 21–29 °C, pH from 5.5 to 7.0, and specific conductance of 6–96 μS cm-1. We had no stream data for specimens of K. skujana, Sheathia americana, or Sirodotia suecica. Among the 3 ecoregions sampled in this study, we collected 5 species in the Piedmont, 6 in the Southeastern Plains, and 1 from the Middle Atlantic Coastal Plain. We collected V. viride-americana from streams in all 3 of these ecoregions, whereas T. americana was collected in Southeastern Plains and Piedmont, but not Middle Atlantic Coastal Plain. We detected the remaining taxa within a single ecoregion (Appendix 1). We obtained DNA sequence data for the rbcL gene from 25 specimens; 20 sequences were newly generated in this study and 5 previously submitted to GenBank from other studies (Appendix 1). Many of the specimens were from Southeastern Naturalist A.M. Redmond, E.K.. Hollingsworth, and M.L. Vis 2019 Vol. 18, No. 3 458 the same species; thus, we did not obtain DNA sequence data from all specimens. Batrachospermum gelatinosum was the only species collected for which rbcL data could not be generated (Appendix 1). Four taxa had more than 1 DNA sequence generated, and those were highly similar within a species. Among the 10 specimens of T. americana sequenced from South Carolina, there were only 8-bp differences (0.6%). For Sheathia heterocortica, there were 5-bp differences (0.4%) among the 4 specimens from South Carolina. Lastly, there were 2-bp differences (0.2%) between the 2 M. australis specimens and no differences between the 2 V. viride-americana specimens. Phylogenetic analyses using both ML and BI showed similar tree topology, but the relationships among Kumanoa, Virescentia, and B. turfosum were not resolved in the BI analysis. The ML tree is shown with both bootstrap and posterior probability support (Fig. 3). The specimens from 8 taxa identified from South Carolina were placed in a clade with other sequences from the same species and had high support values (>90 bootstrap [bs], >0.9 posterior probability [pp]). Likewise, K. skujana, for which there is no other sequence data available, was within a clade of Kumanoa species with high support (>90 bs, >0.9 pp). It is notable that the taxa from this study represent a wide distribution throughout the Batrachospermales clade (Fig. 3). Discussion Numerous taxa from the order Batrachospermales identified via morphology had been previously recorded from South Carolina. This project and recent studies with DNA sequence information have confirmed the presence of B. gelatinosum, B. turfosum, M. australis, Sheathia americana, S. heterocortica, Sirodotia suecica, and T. americana in the state (Lam et al. 2012, Salomaki et al. 2014, Vis et al. 2012). However, we did not document B. trichocontortum in the current study even though it was described as a new species from a locality in South Carolina (Vis and Sheath 1996). In the subsequent years, this species has not been reported from other localities and was not recollected in the type location when visited some years later (M.L. Vis, pers. observ.). This species differs from those to which it is closely related in having a twisted trichogyne. It is possible that this morphological characteristic is environmentally induced rather than taxonomically informative; if that were the case, the specimen may represent B. gelatinosum. For example, specimens with knobs or other protrusions of the trichogyne/carpogonium from streams in Italy with high nitrate concentrations (20.4–53.6 mg.l-1) were identified to be B. gelatinosum from DNA sequence data (Abdelahad et al. 2015). Therefore, it is unclear if B. trichocontortum represents a distinct species or is an ecotypic variant. Both Lemanea and Paralemanea have been recorded from a few locations in South Carolina (Atkinson 1931, Dillard 1967); these locations were not resampled in the current study. In the southeastern US, the genus Paralemanea seems to be common and there has been at least 1 report of Lemanea in the neighboring state of North Carolina (Vis and Sheath 1992). Future research could target these taxa by concentrating sampling efforts on the habitats with high current velocity in which they tend to grow. Southeastern Naturalist 459 A.M. Redmond, E.K. Hollingsworth, and M.L. Vis 2019 Vol. 18, No. 3 Using DNA sequences, we recorded 2 taxa in the present study that had not been previously reported for the state by using morphology alone. Virescentia virideamericana is a widespread taxon in the eastern US and has been collected from Maine to Louisiana, including the neighboring state of North Carolina (House et al. 2008, Necchi et al. 2018, Sheath et al. 1994). Therefore, our documentation of this taxon in 3 locations in South Carolina is not outside the range of this species. We Figure 3. Phylogenetic tree derived from the ML analysis with branch support. Branches with an asterisk (*) = >90 bootstrap (bs) and >0.9 posterior probability (pp) and branches with no numbers had less than 50 bs and less than 0.50 pp. Taxon name and GenBank number provided. When more than 1 GenBank number is given, all specimens had the same sequence. South Carolina specimens in bold; GenBank numbers as in Appendix 1. Southeastern Naturalist A.M. Redmond, E.K.. Hollingsworth, and M.L. Vis 2019 Vol. 18, No. 3 460 also found a second newly reported taxon—K. skujana. This species was originally described from Brazil and previously was unknown outside of Brazil, but it has been suggested that it migtht occur in other locations in North America (Necchi and Vis 2012). Given that other Kumanoa species, such as K.americana, that have been reported from the southeastern US, the occurrence of this species is noteworthy but not unusual. The DNA sequence data produced for this study showed that the specimens of the 9 taxa had few base-pair differences compared with previous sequence data in GenBank. However, it is notable that there appear to be 2 T. americana haplotypes differing by 8 bp. Of the 10 specimens from this study, 3 were identical to sequence data for a specimen from North Carolina (AF029159) and 7 were identical to sequence data for a specimen from Georgia (KM055244). Although these genetic differences fit well within intraspecific variation for members of the Batrachospermales (Lam et al. 2012, Necchi et al. 2018, Salomaki et al. 2015), they may prove interesting in future phylogeographic studies. Data on stream water chemistry were available for 6 species collected in this study. Batrachospermum gelatinosum is known from a wide geographic range in North America and Europe, and collection sites have varied in their stream chemistry (Eloranta et al. 2016, House et al. 2010, Keil et al. 2015, Vis et al. 1996). In this study, the water temperature, pH, and specific conductance measurements from streams containing B. gelatinosum were all within the span of values previously reported (0–22 °C, pH 6.4–8.3, 45–216 μS cm-1; Eloranta et al. 2016, Vis et al. 1996). Virescentia viride-americana is distributed throughout temperate eastern North America (House et al. 2008, Necchi et al. 2018, Sheath et al. 1994). Water chemistry measurements from the current study are within the span of values previously reported for pH (4.9–8.5) and specific conductance (30–320 μS cm-1), but above previous temperatures (8–20 °C) (Sheath et al. 1994), which can be explained by the warmer period of the collections. The range in stream measurements for sites containing M. australis in this study encompasses the previously reported ranges (Vis et al. 2004). The stream temperature (28 °C) of the site where we collected B. turfosum in this study extends the upper bound from a previous study (0–22 °C), and the pH and specific conductance from this study were within the span of values from the previous study (pH 3.9–8.2, 18–130 μS cm-1) (Sheath et al. 1994). Likewise, the stream temperature at one of the Tuomeya americana sites was 29 °C, which is above the values from the previous study (5–26°C), while the pH and specific conductance ranges were within the previous spans reported (pH 5.5–8.1, 10–100 μS cm-1) (Kaczmarczyk et al. 1992). Prior to this study, water parameter measurements for Sheathia heterocortica were only recorded at a single location; the previous temperature (22 °C) was within the span of values recorded in the present study, while previous pH and specific conductance values (pH 8.3, 220 μS cm-1, respectively) were greater than this study’s (pH 6.2–6.7 and 51–119 μS cm-1) (Sheath and Cole 1990). Overall, freshwater red algae classified in the Batrachospermales appear to be well represented in the streams of South Carolina. Currently, there are 4 sections Southeastern Naturalist 461 A.M. Redmond, E.K. Hollingsworth, and M.L. Vis 2019 Vol. 18, No. 3 of Batrachospermum and 10 genera reported from North America (Chapuis et al. 2017, Evans et al. 2017, Necchi et al. 2018, Sheath and Vis 2015). Our study, in South Carolina, reported the 2 Batrachospermum sections (Batrachospermum and Turfosa) and 5 genera (Kumanoa, Montagnia, Sheathia, Sirodotia, Tuomeya, and Virescentia), which along with 2 older reports of Lemanea and Paralemanea, is ~64% of the diversity known in North America. The genera Balliopsis, Lympha, Torularia, and Volatus were not collected in previous studies nor by this study from South Carolina. However, all but Balliopsis have been reported from nearby states. Sheath and Vis (2015) reported 38 species in the Batrachospermales, and 6 species were added in 2 more recent papers (Chapuis et al. 2017, Evans et al. 2017) for a total of 44 species in North America. Therefore, ~20% of the freshwater red algal species diversity currently known for North America has now been recorded in South Carolina. The number of species recorded in the state relative to the number known on the continent suggests that the state’s richness represents high diversity, but we are unaware of other comparable surveys. This richness may still be an underestimation, and more discoveries could be made by targeting more specialized habitats and taxa that are known from neighboring states but not yet reported from South Carolina. Acknowledgments We thank the Ohio University Genomics Facility for performing Sanger sequencing. We are grateful to the members of the Aquatic Biology Section of the South Carolina Department of Health and Environmental Control, especially Scott Castleberry and Justin Lewandowski, for assistance in collection of specimens. This research was partially funded by a National Science Foundation (NSF) grant DEB 1655230. Any opinions, findings, and conclusions or recommendations expressed in this material are those of the authors and do not necessarily reflect the views of NSF. Literature Cited Abdelahad, N., R. Bolpagni, G.J. Lasinio, M.L. Vis, C. Amadio, and E.J. Keil. 2015. Distribution, morphology, and ecological niche of Batrachospermum and Sheathia species (Batrachospermales, Rhodophyta) in the fontanili of the Po plain (northern Italy). European Journal of Phycology 50:318–329. Atkinson, G.F. 1931. Notes on the genus Lemanea in North America. The Botanical Gazette 92:225–242. Carey, R.O., G. Vellidis, R. Lowrance, and C.M. Pringle. 2007. Do nutrients limit algal periphyton in small blackwater coastal plain streams? Journal of the American Water Resources Association 43:1183–1193. Chapuis, I.S., O. Necchi Jr., G.C. Zuccarello, S. Xie, M. Aboal, P.M. Sánchez Castillo, and M.L. Vis. 2017. A new genus, Volatus, and four new species of Batrachospermum sensu stricto (Batrachospermales, Rhodophyta). Phycologia 56:454–468. Dillard, G.E. 1967. The fresh-water algae of South Carolina. 1. Previous work and recent additions. Journal of the Elisha Mitchell Society 83:128–131. Eloranta, P., and J. Kwandrans. 2007. Freshwater red algae (Rhodophyta). Identification guide to European taxa, particularly to those in Finland. Norrlinia 15:1–103. Southeastern Naturalist A.M. Redmond, E.K.. Hollingsworth, and M.L. Vis 2019 Vol. 18, No. 3 462 Eloranta, P., A. Eloranta, and P. Perämäki. 2016. Intensive study of freshwater red algae (Rhodophyta) in Finland. Fottea 16:122–132. Entwisle, T.J., M.L. Vis, W.B. Chiasson, O. Necchi Jr., and A.R. Sherwood. 2009. Systematics of the Batrachospermales: A synthesis. Journal of Phycology 45:704–715. Evans, J.R., I.S. Chapuis, and M.L. Vis. 2017. Adding to the freshwater red algal diversity in North America: Lympha mucosa gen. et sp. nov. (Batrachospermales, Rhodophyta). Algae 32:171–179. Goldstein, A.K., and J.J. Manzi. 1976. Additions to the freshwater algae of South Carolina. Journal of the Elisha Mitchell Society 92:9–13. Griffith, G.E., J.M. Omernik, J.A. Comstock, M.P. Schafale, W.H. McNab, D.R. Lenat, T.F. MacPherson, J.B. Glover, and V.B. Shelburne. 2002. Ecoregions of North and South Carolina (map scale 1:1,500,000). US Geological Survey Reston, VA. Available online at ftp://newftp.epa.gov/EPADataCommons/ORD/Ecoregions/nc/ncsc_front.pdf. Accessed 22 January 2018. Guiry, M.D., and G.M. Guiry. AlgaeBase. 2018. National University of Ireland, Galway, Ireland. Available online at http://www.algaebase.org. Accessed 19 November 2018. House, D.L., A.R. Sherwood, and M.L. Vis. 2008. Comparison of three organelle markers for phylogeographic inference in Batrachospermum helminthosum (Batrachospermales, Rhodophyta) from North America. Phycological Research 56:69–75. House, D.L., A.M. Vandenbroek, and M.L. Vis. 2010. Intraspecific genetic variation of Batrachospermum gelatinosum (Batrachospermales, Rhodophyta) in eastern North America. Phycologia 49:501–507. Howard, R.V., and B.C. Parker. 1980. Revision of Boldia erythrosiphon Herndon (Rhodophyta, Bangiales). American Journal of Botany 67:413–422. Jacobs, J.E. 1968. A preliminary check list of fresh-water algae in South Carolina. Journal of the Elisha Mitchell Society 84:454–457. Kaczmarczyk, D., R.G. Sheath, and K.M. Cole. 1992. Distribution and systematics of the freshwater genus Tuomeya (Rhodophyta, Batrachospermaceae). Journal of Phycology 28:850–855. Kearse, M., R. Moir, A. Wilson, S. Stones-Havas, M. Cheung, S. Sturrock, S. Buxton, A. Cooper, et al. 2012. Geneious Basic: An integrated and extendable desktop software platform for the organization and analysis of sequence data. Bioinformatics 28:1647–1649. Keil, E.J., T.R. Macy, J. Kwandrans, P. Eloranta, P. Tomás, M. Aboal, and M.L.Vis. 2015. Phylogeography of Batrachospermum gelatinosum (Batrachospermales, Rhodophyta) shows postglacial expansion in Europe. Phycologia 54:176–182. Kumano, S. 2002. Freshwater red algae of the world. Biopress Limited, Bristol, UK. 375 pp. Lam, D.W., T.J. Entwisle, P. Eloranta, J. Kwandrans, and M.L. Vis. 2012. Circumscription of species in the genus Sirodotia (Batrachospermales, Rhodophyta) based on molecular and morphological data. European Journal of Phycology 47:42–50. Necchi, O., Jr., and M.L. Vis. 2012. Monograph of the genus Kumanoa (Rhodophyta, Batrachospermales). Bibliotheca Phycologica 116:1–79. Necchi, O., Jr., R.G. Sheath, and K.M. Cole. 1993a. Systematics of freshwater Audouinella (Acrochaetiaceae, Rhodophyta) in North America. 1. The reddish species. Algological Studies 70:11–28. Necchi, O., Jr., R.G. Sheath, and K.M. Cole. 1993b. Systematics of freshwater Audouinella (Acrochaetiaceae, Rhodophyta) in North America. 2. The bluish species. Algological Studies 71:13–21. Southeastern Naturalist 463 A.M. Redmond, E.K. Hollingsworth, and M.L. Vis 2019 Vol. 18, No. 3 Necchi, O., Jr., R.G. Sheath, and K.M. Cole. 1993c. Distribution and systematics of the freshwater genus Sirodotia (Batrachospermales, Rhodophyta) in North America. Journal of Phycology 29:236–243. Necchi, O., Jr., D.C. Agostinho, and M.L. Vis. 2018. Revision of Batrachospermum Section Virescentia (Batrachospermales, Rhodophyta) with the establishment of the new genus, Virescentia stat. nov. Cryptogamie Algologie 39:313–338. Necchi, O., Jr., A. Garcia Filho, M.O. Paiano, and M.L. Vis.2019. Revision of Batrachospermum section Macrospora (Batrachospermales, Rhodophyta) with the establishment of the new genus Montagnia. Phycologia early online. DOI: 10.1080/00318884.2019.1624143. Ronquist, F., M. Teslenko, P. Van Der Mark, D.L. Ayres, A. Darling, S. Höhna, B. Larget, L. Liu, M.A. Suchard, and J.P. Huelsenbeck. 2012. MrBayes 3.2: Efficient Bayesian phylogenetic inference and model choice across a large model space. Systematic Biology 61:539–542. Salomaki, E.D., J. Kwandrans, P. Eloranta, and M.L. Vis. 2014. Molecular and morphological evidence for Sheathia gen. nov. (Batrachospermales, Rhodophyta) and three new species. Journal of Phycology 50:526–542. Sheath, R.G. 1984. The biology of freshwater algae. Progress in Phycological Research 3:89–157. Sheath, R.G., and K.M. Cole. 1990. Batrachospermum heterocorticum sp. nov. and Polysiphonia subtilissima (Rhodophyta) from Florida spring-fed streams. Journal of Phycology 26:563–568. Sheath, R.G., and K.M. Cole. 1993. Distribution and systematics of Batrachospermum (Batrachospermales, Rhodophyta) in North America. 2. Chromosome numbers. Phycologia 32:304–306. Sheath, R.G., and J.A. Hambrook. 1990. Freshwater ecology. Pp. 423–453, In R.G. Sheath and K.M. Cole (Eds.). Biology of the Red Algae. Cambridge University Press, New York, NY. 517 pp. Sheath, R.G., and M.L. Vis. 2015. Red algae. Pp. 237–264, In J.D. Wehr, R.G. Sheath, and J.P. Kociolek. Freshwater Algae of North America 2nd Edition. Academic Press, San Diego, CA. 1050 pp. Sheath, R.G., M.L. Vis, and K.M. Cole. 1994. Distribution and systematics of Batrachospermum (Batrachospermales, Rhodophyta) in North America. 5. Section Aristata. Phycologia 33:404–414. Sheath, R.G., K.M. Müller, D.J. Larson, and K.M. Cole. 1995. Incorporation of freshwater Rhodophyta into the cases of caddisflies (Trichoptera) from North America. Journal of Phycology 31:889–896. Sheath, R.G., K.M. Müller, M.H. Colbo, and K.M. Cole. 1996. Incorporation of freshwater Rhodophyta into the cases of chironomid larvae (Chironomidae, Diptera) from North America. Journal of Phycology 32:949–952. Stamatakis, A. 2014. RAxML version 8: A tool for phylogenetic analysis and post-analysis of large phylogenies. Bioinformatics 30:1312–1313. Stancheva, R., and R.G. Sheath. 2016. Benthic soft-bodied algae as bioindicators of stream water quality. Knowledge and Management of Aquatic Ecosystems 417:15. Vis, M.L., and R.G. Sheath. 1992. Systematics of the freshwater red algal family Lemaneaceae in North America. Phycologia 31:164–179. Vis, M.L., and R.G. Sheath. 1996. Distribution and systematics of Batrachospermum (Batrachospermales, Rhodophyta) in North America. 9. Section Batrachospermum: Description of five new species. Phycologia 35:124–134. Southeastern Naturalist A.M. Redmond, E.K.. Hollingsworth, and M.L. Vis 2019 Vol. 18, No. 3 464 Vis, M.L., R.G. Sheath, and K.M. Cole. 1996. Distribution and systematics of Batrachospermum (Batrachospermales, Rhodophyta) in North America. 8b. Section Batrachospermum: Previously described species excluding Batrachospermum gelatinosum. European Journal of Phycology 31:189–199. Vis, M.L., G.W. Saunders, R.G. Sheath, K. Dunse, and T.J. Entwisle. 1998. Phylogeny of the Batrachospermales (Rhodophyta) inferred from rbcL and 18S ribosomal DNA gene sequences. Journal of Phycology 34:341–350. Vis, M.L., R.G. Sheath, and W.B Chiasson. 2004. A survey of the Rhodophyta and associated macroalgae from coastal streams in French Guiana. Cryptogamie Algologie 25:153–166. Vis, M.L., O. Necchi Jr., W.B. Chiasson, and T.J. Entwisle. 2012. Molecular phylogeny of the genus Kumanoa (Batrachospermales, Rhodophyta). Journal of Phycology 48:750–758. Wolle, F. 1882. Fresh-water algae. VI. Torrey Botanical Club 9:25–30. Yoon, H.S., K.M. Müller, R.G Sheath, F.D. Ott, and D. Bhattacharya. 2006. Defining the major lineages of red algae (Rhodophyta). Journal of Phycology 42:482–492. Southeastern Naturalist 465 A.M. Redmond, E.K. Hollingsworth, and M.L. Vis 2019 Vol. 18, No. 3 Appendix 1. Collection information (location, latitude [°N], longitude [°W], herbarium voucher specimens) and data for locations at which we sampled freshwater red algae. Site number as in Figure 1. A dash denotes no data. Water Specific rbcL Publication for Site temp. conductance Ecoregion GenBank GenBank # Collection information Date (°C) pH (μS.cm-1) (major) Taxon number number 1 Toxaway Creek at SR 34, Oconee 16.viii.2012 22 6.9 65 Piedmont T. americana MG321580 This study County, SC, 34.65731787, 83.18110147, BHO A-1089 2 Ramsey Creek, SC, 34.682033167, 25.viii.2009 22 6.2 51 Piedmont Sheathia heterocortica JX669796 Salomaki et al. 2014 83.14631045, BHO A-0061, 25.viii.2009 22 6.2 51 Piedmont Sheathia heterocortica MG321564 This study A-0093 A-0311 25.viii.2009 22 6.2 51 Piedmont B. gelatinosumA - 25.viii.2009 22 6.2 51 Piedmont T. americana - 3 Langham Creek, SC, 34.76926, 11.viii.2009 23 6.7 119 Piedmont Sheathia heterocortica JX669758 Salomaki et al. 2014 83.01149, BHO A-0062 4 Little Cane Creek, SC, 34.7692689, 25.viii.2009 23 6.9 45 Piedmont T. americana MG321566 This study 83.0114982, BHO A-0125, 25.viii.2009 23 6.9 45 Piedmont V. viride-americana MG321571 This study A-0291, A-0024, A-0313 31.vii.2010 - - - Piedmont S. heterocortica MG321563 This study 31.vii.2010 - - - Piedmont T. americana MG321576 This study 5 Snow Creek at SR 51, Oconee 16.viii.2012 21 6.5 51 Piedmont T. americana MG321578 This study County, SC, 34.62361839, 82.99464525, BHO A-1083 6 Buck Creek at Peach Shed Road, 1.ix.2009 22 6.5 31 Piedmont T. americana MG321575 This study Spartanburg County, SC, 35.111326, 17.viii.2012 - - - Piedmont T. americana - 81.893809, BHO A-0312, A-1092 7 Suck Creek, SC, 35.17904594, 21.viii.2009 - - - Piedmont K. skujana JN5890008 Vis et al. (2012) 81.77741736, BHO A-0232 8 Simmons Creek, SC, 34.35548275, 23.vi.2009 Piedmont Sheathia americana JX669795 Salomaki et al. 2014 81.8863821, BHO A-0317a, 23.vi.2009 - - - Piedmont V. viride-americana MG321577 This study A-0317b Southeastern Naturalist A.M. Redmond, E.K.. Hollingsworth, and M.L. Vis 2019 Vol. 18, No. 3 466 Water Specific rbcL Publication for Site temp. conductance Ecoregion GenBank GenBank # Collection information Date (°C) pH (μS.cm-1) (major) Taxon number number 9 Steven’s Creek at SC 23, SC, 23.vi.2010 30 7.3 138 Piedmont V. viride-americana - 33.7294532, 82.1822998, BHO A-0101 10 Oconee Creek at SR 129, Oconee 16.viii.2012 23 7.0 40 Piedmont T. americana MG321581 This study County, SC, 33.84058078, 81.98948165, BHO A-1094 11 Wildcat Creek at SR 39, Lancaster 16.viii.2012 25 6.7 96 Piedmont T. americana MG321579 This study County, SC, 34.74425328, 80.54156474, BHO A-1085 12 Grannie’s Quarter, CW-078, SC, 1.ix.2009 - - - Piedmont T. americana MG321574 This study 34.402453, 80.641947, BHO A-0297 13 Sanders Creek at SC 97, Kershaw 18.vii.2012 27 5.5 21 SE Plains M. australis - County, SC, 34.316325, 80.641708, BH0 A-1077 14 Little Pine Creek at SR 132, 13.viii.2008 - - - SE Plains M. australis MG321568 This study Kershaw County, SC, 34.271461, 18.vii.2012 24 5.5 20 SE Plains M. australis - 80.587686,BHO A-0151, A-1086 15 Skipper Creek at SC 145, SC, 30.vi.2010 26 5.3 15 SE Plains M. australis - 34.6227847, 80.1901289, BHO A-135 16 McTier Creek, SC, 33.7536023, 21.vii.2009 22 5.8 6 SE Plains T. americana - 81.6016588, BHO A-0306, A-0295 7.ix.2010 - - - SE Plains T. americana MG321573 This study 17 Little Horse Creek at SR 104, Aiken 15.ix.2010 - - - SE Plains T. americana - - County, SC, 33.5639, 81.874213, 3.vii.2012 29 5.9 22 SE Plains T. americana - - BHO A-0298, A-1093 Southeastern Naturalist 467 A.M. Redmond, E.K. Hollingsworth, and M.L. Vis 2019 Vol. 18, No. 3 Water Specific rbcL Publication for Site temp. conductance Ecoregion GenBank GenBank # Collection information Date (°C) pH (μS.cm-1) (major) Taxon number number 18 Shaw’s Creek at SR 153, Aiken 22.vii.2009 21 5.5 7 SE Plains T. americana MG321572 This study County, SC, 33.658875, 81.718127, 7.ix.2010 - - - SE Plains M. australis - BHO A-0293, A-0156, A-1088 29.vii.2012 24 6.1 37 SE Plains M. australis - 19 Rocky Springs Creek at Moore 3.vii.2012 26 5.4 15 SE Plains M. australis - Road, Aiken County, SC, 33.660925, 81.557007, BHO A-1080 20 Black Creek at SR 278, Lexington 21.vii.2009 - - - SE Plains M. australis - County, SC, 33.7324142, 4.ix.2010 23 5.6 2 SE Plains M. australis MG321570 This study 81.3031812, BHO A-0155, A-0157, 5.viii.2012 25 5.6 30 SE Plains M. australis - A-1081 21 Hollow Creek at SR 5, Aiken County, 18.vi.2010 22 6.3 12 SE Plains M. australis - SC, 33.340036, 81.8219917, 3.vii.2012 23 5.7 15 SE Plains M. australis - BHO A-0139, A-1079 22 Cedar Creek at SR 79, Aiken 18.vi.2010 21 6.1 - SE Plains M. australis - County,SC, 33.4535488, 2.vii.2012 20 5.4 20 SE Plains M. australis - 81.6428341, BH0 A-0141, A-1087 23 Upper Three Runs Creek at SR 113, 18.vi.2010 21 5.4 18 SE Plains M. australis - Aiken County, SC, 33.4762662, 3.vii.2012 - - - SE Plains M. australis 81.5884466, BHO A-0137, A-1091 24 Little Salkehatchie River, SC, 2.ix.2009 19 7.5 195 SE Plains V. viride-americana - 33.3109941, 81.1929748, BHO A-0127 25 Sandy Run Creek at US 176, 3.viii.2012 28 5.8 25 SE Plains B. turfosum - Calhoun County, SC, 33.48078, 80.580209, BHO A-1078 Southeastern Naturalist A.M. Redmond, E.K.. Hollingsworth, and M.L. Vis 2019 Vol. 18, No. 3 468 Water Specific rbcL Publication for Site temp. conductance Ecoregion GenBank GenBank # Collection information Date (°C) pH (μS.cm-1) (major) Taxon number number 26 Cedar Creek at SR 734, Richland 28.i.2009 - - - SE Plains M. australis MG321569 This study County, SC, 33.8411981, 6.viii.2009 - - - SE Plains B. turfosum MG372122 This study 80.85997581, BHO A-0153, 2.viii.2012 23 5.6 21 SE Plains M. australis - A-0211, A-1090 27 Cedar Creek, DHEC site RS-09312, 10.vi.2009 25 6.1 2 SE Plains M. australis MG321567 This study SC, 33.927148, 80.819343, BH0 A-0149 28 Big Beaver Creek at US Highway 16.v.2008 - - - SE Plains Sirodotia suecica JF344718 Lam et al. 2012 176, Calhoun County, SC, 5.viii.2012 25 5.3 16 SE Plains M. australis - 33.759551, 80.914301, BHO A-0267, A-1082 29 Cedar Creek at SR 66, Richland 3.viii.2012 24 5.2 22 SE Plains B. macrosporum - County, SC, 33.897136, 80.819206, BHO A-1084 30 Cow Castle Creek at bridge on 17.ii.2009 - - - Mid-Atlantic Virescentia viride- MG321565 This study S-38-198, SC, 33.41942, 80.74017, Coastal Plain americana BHO A-0118 ANo rbcL sequence data were generated for BHO A-0093; however, COI-5P data from House et al. (2010) confirm its identity as Batrachospermum gelatinosum.